Detail of EST/Unigene AW692878 |
Acc. | AW692878 |
Internal Acc. | NF060F01ST1F1013 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Abscisic-aldehyde oxidase OS=Arabidopsis thaliana E-value=4e-54; Benzaldehyde dehydrogenase (NAD(+)) OS=Arabidopsis thaliana E-value=2e-53; Indole-3-acetaldehyde oxidase OS=Arabidopsis thaliana E-value=4e-52; Indole-3-acetaldehyde oxidase OS=Arabidopsis thaliana E-value=1e-50; Indole-3-acetaldehyde oxidase OS=Zea mays E-value=3e-49; |
Length | 509 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2 (1 ESTs); |
Sequence | GTATCCTGTGCACTCGCAGCACAAAAATTACAGCGAGCTGTCAGAATGTATCTTAATCGA |
EST members of Unigene | AW692878 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00157 aldehyde oxidase; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K00157 aldehyde oxidase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00157 aldehyde oxidase; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K00157 aldehyde oxidase; Metabolism > Metabolism of Cofactors and Vitamins > ko00760 Nicotinate and nicotinamide metabolism > K00157 aldehyde oxidase; Metabolism > Metabolism of Cofactors and Vitamins > ko00750 Vitamin B6 metabolism > K00157 aldehyde oxidase |
EC | 1.2.3.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.5214.1.S1_at
|
Corresponding NCBI Gene | 817257 |
Trichome-related Gene from Literature | N/A |