Detail of EST/Unigene AW694154 |
Acc. | AW694154 |
Internal Acc. | NF072H05ST1F1047 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Cytosolic purine 5'-nucleotidase OS=Dictyostelium discoideum E-value=1e-22; Cytosolic purine 5'-nucleotidase OS=Bos taurus E-value=2e-20; Cytosolic purine 5'-nucleotidase OS=Pongo abelii E-value=3e-20; Cytosolic purine 5'-nucleotidase OS=Mus musculus E-value=3e-20; Cytosolic purine 5'-nucleotidase OS=Homo sapiens E-value=3e-20; |
Length | 581 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2 (1 ESTs); |
Sequence | TGAGACTATATCGATGATATATAATTTATTTCAGATGGTTGACAGATTGGATGATGGGAC |
EST members of Unigene | AW694154 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K01081 5'-nucleotidase; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K01081 5'-nucleotidase; Metabolism > Metabolism of Cofactors and Vitamins > ko00760 Nicotinate and nicotinamide metabolism > K01081 5'-nucleotidase |
EC | 3.1.3.5 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.32501.1.S1_s_at
|
Corresponding NCBI Gene | 834954 |
Trichome-related Gene from Literature | N/A |