| Detail of EST/Unigene AW697223 |
| Acc. | AW697223 |
| Internal Acc. | NF113D10ST1F1089 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Calcium-dependent protein kinase C OS=Aplysia californica E-value=4e-08; Protein kinase C, eye isozyme OS=Drosophila melanogaster E-value=7e-07; Protein kinase C, brain isozyme OS=Drosophila melanogaster E-value=9e-07; Ras GTPase-activating protein 4 OS=Homo sapiens E-value=2e-06; Putative Ras GTPase-activating protein 4B OS=Homo sapiens E-value=2e-06; |
| Length | 778 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2 (1 ESTs); |
| Sequence | CCATTTTCAAACCCCTCATACCCATCACAACCCAAACCAACAAAATCCCAAACCTCCACC |
| EST members of Unigene | AW697223 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04020 Calcium signaling pathway > K02677 classical protein kinase C; Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K02677 classical protein kinase C; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K02677 classical protein kinase C; Environmental Information Processing > Signal Transduction > ko04011 MAPK signaling pathway - yeast > K02677 classical protein kinase C; Environmental Information Processing > Signal Transduction > ko04070 Phosphatidylinositol signaling system > K02677 classical protein kinase C; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K02677 classical protein kinase C; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K02677 classical protein kinase C |
| EC | 2.7.11.- 2.7.11.13 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.32616.1.S1_at
|
| Corresponding NCBI Gene | 831665 |
| Trichome-related Gene from Literature | N/A |