Detail of EST/Unigene AW774268 |
Acc. | AW774268 |
Internal Acc. | EST333419 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Endo-1,3;1,4-beta-D-glucanase OS=Zea mays E-value=4e-36; Carboxymethylenebutenolidase homolog OS=Mus musculus E-value=5e-20; Protein AIM2 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=7e-20; Carboxymethylenebutenolidase homolog OS=Xenopus laevis E-value=2e-19; Carboxymethylenebutenolidase homolog OS=Pongo abelii E-value=2e-19; |
Length | 645 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3 (1 ESTs); |
Sequence | ACCGGTCAAGTTCTCATTGTCTTGAAAATCCACCTAACCTGAACTCAGGTATCCATGGAG |
EST members of Unigene | AW774268 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00627 1,4-Dichlorobenzene degradation > K01061 carboxymethylenebutenolidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00364 Fluorobenzoate degradation > K01061 carboxymethylenebutenolidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00361 gamma-Hexachlorocyclohexane degradation > K01061 carboxymethylenebutenolidase |
EC | 3.1.1.45 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.14976.1.S1_at
|
Corresponding NCBI Gene | 821939 |
Trichome-related Gene from Literature | N/A |