Detail of EST/Unigene AW774279 |
Acc. | AW774279 |
Internal Acc. | EST333430 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Methionine--tRNA ligase OS=Thermosynechococcus elongatus (strain BP-1) E-value=2e-42; Methionine--tRNA ligase OS=Nostoc sp. (strain PCC 7120 / UTEX 2576) E-value=5e-42; Methionine--tRNA ligase OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=4e-40; Methionine--tRNA ligase OS=Thermotoga maritima (strain ATCC 43589 / MSB8 / DSM 3109 / JCM 10099) E-value=4e-37; Methionine--tRNA ligase OS=Clostridium perfringens (strain 13 / Type A) E-value=5e-37; |
Length | 582 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3 (1 ESTs); |
Sequence | CGTGAGAATGAACTGTTCCTTACAGAACACACTCTCCATTCTTTCACTCCGTTCCAATTC |
EST members of Unigene | AW774279 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K01874 methionyl-tRNA synthetase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01874 methionyl-tRNA synthetase; Genetic Information Processing > Translation > ko00970 Aminoacyl-tRNA biosynthesis > K01874 methionyl-tRNA synthetase |
EC | 6.1.1.10 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.27342.1.S1_at
|
Corresponding NCBI Gene | 824706 |
Trichome-related Gene from Literature | N/A |