| Detail of EST/Unigene AW774619 |
| Acc. | AW774619 |
| Internal Acc. | EST333770 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Hexokinase-3 OS=Arabidopsis thaliana E-value=1e-34; Hexokinase-1 OS=Arabidopsis thaliana E-value=5e-33; Hexokinase-2 OS=Arabidopsis thaliana E-value=8e-33; Hexokinase-2 OS=Oryza sativa subsp. japonica E-value=3e-32; Hexokinase-2 OS=Solanum tuberosum E-value=7e-32; |
| Length | 681 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SEEDROOT_KV3 (1 ESTs); |
| Sequence | TACATCCTTTCTCTCTCTTACTTTCGCCGGAAAATTAAATCTCCGGCGAGTTTTCCGTTT |
| EST members of Unigene | AW774619 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00530 Aminosugars metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00844 hexokinase |
| EC | 2.7.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.11978.1.S1_at
|
| Corresponding NCBI Gene | 841468 |
| Trichome-related Gene from Literature | N/A |