| Detail of EST/Unigene AW774745 |
| Acc. | AW774745 |
| Internal Acc. | EST333896 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Non-functional NADPH-dependent codeinone reductase 2 OS=Papaver somniferum E-value=2e-48; NADPH-dependent codeinone reductase 1-2 OS=Papaver somniferum E-value=3e-45; NADPH-dependent codeinone reductase 1-1 OS=Papaver somniferum E-value=1e-44; NADPH-dependent codeinone reductase 1-4 OS=Papaver somniferum E-value=1e-44; Probable NAD(P)H-dependent oxidoreductase 1 OS=Oryza sativa subsp. japonica E-value=1e-44; |
| Length | 652 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SEEDROOT_KV3 (1 ESTs); |
| Sequence | TATGCCAATGATAGGTTTAGGGACATCAACAAGTCCCTCTCCACCACATGAAGTCCTCAC |
| EST members of Unigene | AW774745 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00011 aldehyde reductase; Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00011 aldehyde reductase; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00037 3-alpha-hydroxysteroid dehydrogenase; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K00037 3-alpha-hydroxysteroid dehydrogenase; Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00037 3-alpha-hydroxysteroid dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00212 trans-1,2-dihy |
| EC | 1.1.1.21 1.1.1.213 1.1.1.225 1.1.1.50 1.3.1.20 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.1724.1.S1_at
|
| Corresponding NCBI Gene | 842290 |
| Trichome-related Gene from Literature | N/A |