| Detail of EST/Unigene AW775434 |
| Acc. | AW775434 |
| Internal Acc. | EST334499 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3, chloroplastic OS=Pisum sativum E-value=5e-95; Chlorophyll a-b binding protein 8, chloroplastic OS=Solanum lycopersicum E-value=5e-92; Chlorophyll a-b binding protein, chloroplastic OS=Petunia hybrida E-value=1e-24; Chlorophyll a-b binding protein 7, chloroplastic OS=Solanum lycopersicum E-value=6e-24; Chlorophyll a-b binding protein 4, chloroplastic OS=Arabidopsis thaliana E-value=2e-22; |
| Length | 623 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL; |
| Sequence | TAAGCTGTGAGACACAGTTTTGGAGCAAGATCACTCCCATCTTCAATAGGGTCTTCTATA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842446 |
| Trichome-related Gene from Literature | N/A |