| Detail of EST/Unigene AW775862 |
| Acc. | AW775862 |
| Internal Acc. | EST334927 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein CP26, chloroplastic OS=Arabidopsis thaliana E-value=3e-78; Chlorophyll a-b binding protein of LHCII type I, chloroplastic OS=Dunaliella tertiolecta E-value=2e-29; Chlorophyll a-b binding protein type 2 member 1B, chloroplastic OS=Pinus sylvestris E-value=9e-29; Chlorophyll a-b binding protein M9, chloroplastic OS=Zea mays E-value=2e-28; Chlorophyll a-b binding protein, chloroplastic OS=Zea mays E-value=2e-28; |
| Length | 704 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL; |
| Sequence | CTTAGTTTGAGTTGAAGATTCCTAAAACCAACCATGGCTTCCATTGCTGCTTCTACTGCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 826626 |
| Trichome-related Gene from Literature | N/A |