Detail of EST/Unigene AW775961 |
Acc. | AW775961 |
Internal Acc. | EST335026 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=0; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=1e-99; |
Length | 668 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | GCCGAGGGCTTTATTACTTTACTTAGTAAGCAAAAAAATACCACAATGGCTGCTTCAACA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |