| Detail of EST/Unigene AW776080 |
| Acc. | AW776080 |
| Internal Acc. | EST335145 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 4-coumarate--CoA ligase-like 9 OS=Arabidopsis thaliana E-value=2e-87; 4-coumarate--CoA ligase-like 6 OS=Oryza sativa subsp. japonica E-value=7e-80; 4-coumarate--CoA ligase-like 5 OS=Oryza sativa subsp. japonica E-value=5e-73; 4-coumarate--CoA ligase-like 7 OS=Oryza sativa subsp. japonica E-value=1e-72; 4-coumarate--CoA ligase-like 5 OS=Arabidopsis thaliana E-value=6e-72; |
| Length | 625 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL; |
| Sequence | TGGTCTGACTGAAAGTGGAGGAGGGGCAGCAAGAATGATAGGTTTTGATGAAGCTAAGCG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K01896 medium-chain acyl-CoA synthetase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K01897 long-chain acyl-CoA synthetase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K01904 4-coumarate--CoA ligase |
| EC | 6.2.1.12 6.2.1.3 |
| Transcription Factor Family | |
| Transporter Classification Family | 2.A.1 Major facilitator superfamily MFS |
| Probeset |
|
| Corresponding NCBI Gene | 836457 |
| Trichome-related Gene from Literature | N/A |