Detail of EST/Unigene AW776080 |
Acc. | AW776080 |
Internal Acc. | EST335145 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 4-coumarate--CoA ligase-like 9 OS=Arabidopsis thaliana E-value=2e-87; 4-coumarate--CoA ligase-like 6 OS=Oryza sativa subsp. japonica E-value=7e-80; 4-coumarate--CoA ligase-like 5 OS=Oryza sativa subsp. japonica E-value=5e-73; 4-coumarate--CoA ligase-like 7 OS=Oryza sativa subsp. japonica E-value=1e-72; 4-coumarate--CoA ligase-like 5 OS=Arabidopsis thaliana E-value=6e-72; |
Length | 625 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | TGGTCTGACTGAAAGTGGAGGAGGGGCAGCAAGAATGATAGGTTTTGATGAAGCTAAGCG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K01896 medium-chain acyl-CoA synthetase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K01897 long-chain acyl-CoA synthetase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K01904 4-coumarate--CoA ligase |
EC | 6.2.1.12 6.2.1.3 |
Transcription Factor Family | |
Transporter Classification Family | 2.A.1 Major facilitator superfamily MFS |
Probeset |
|
Corresponding NCBI Gene | 836457 |
Trichome-related Gene from Literature | N/A |