Detail of EST/Unigene AW776337 |
Acc. | AW776337 |
Internal Acc. | EST335402 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 8 OS=Arabidopsis thaliana E-value=2e-11; Glucan endo-1,3-beta-glucosidase 9 OS=Arabidopsis thaliana E-value=3e-11; Glucan endo-1,3-beta-glucosidase 5 OS=Arabidopsis thaliana E-value=1e-10; Glucan endo-1,3-beta-glucosidase 6 OS=Arabidopsis thaliana E-value=1e-07; Glucan endo-1,3-beta-glucosidase 1 OS=Arabidopsis thaliana E-value=6e-06; |
Length | 587 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | CTTAACTACGGAGGTTCGTGTAATGAAATTGGTGAGAAGGGTAACATATCATATGCTTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827429 |
Trichome-related Gene from Literature | N/A |