Detail of EST/Unigene AW776413 |
Acc. | AW776413 |
Internal Acc. | EST335478 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 1, chloroplastic OS=Pisum sativum E-value=0; Oxygen-evolving enhancer protein 1, chloroplastic OS=Nicotiana tabacum E-value=3e-85; Oxygen-evolving enhancer protein 1, chloroplastic OS=Solanum tuberosum E-value=2e-84; Oxygen-evolving enhancer protein 1, chloroplastic OS=Solanum lycopersicum E-value=9e-83; Oxygen-evolving enhancer protein 1, chloroplastic OS=Helianthus annuus E-value=1e-80; |
Length | 660 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | ACATAGGAGCAATGGCAGCCTCACTCCAAGCAGCTGCTACTCTCATGCAACCAACCAAGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836789 |
Trichome-related Gene from Literature | N/A |