Detail of EST/Unigene AW776989 |
Acc. | AW776989 |
Internal Acc. | EST336054 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Carboxymethylenebutenolidase homolog OS=Rattus norvegicus E-value=6e-06; Carboxymethylenebutenolidase homolog OS=Pongo abelii E-value=1e-05; Carboxymethylenebutenolidase homolog OS=Homo sapiens E-value=1e-05; |
Length | 601 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | CACCAGGGTAAAGTGAAGATGGGGCTAGCAACAGCAAGAGCAACTGTAAGCATTTGTGGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00627 1,4-Dichlorobenzene degradation > K01061 carboxymethylenebutenolidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00364 Fluorobenzoate degradation > K01061 carboxymethylenebutenolidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00361 gamma-Hexachlorocyclohexane degradation > K01061 carboxymethylenebutenolidase |
EC | 3.1.1.45 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 840434 |
Trichome-related Gene from Literature | N/A |