Detail of EST/Unigene AW777029
Acc. AW777029
Internal Acc. M111079e
Type EST
Annotation (Top 5 hits in Uniprot_trembl) 26S protease regulatory subunit 6B homolog OS=Solanum tuberosum E-value=5e-16; 26S protease regulatory subunit 6B homolog OS=Helianthus annuus E-value=5e-16; 26S protease regulatory subunit 6B homolog OS=Arabidopsis thaliana E-value=5e-16; 26S protease regulatory subunit 6B homolog OS=Dictyostelium discoideum E-value=2e-15; 26S protease regulatory subunit 6B OS=Rattus norvegicus E-value=5e-14;
Length 116 nt
Species Medicago truncatula
Belonged EST Libraries MT_IROOT_DSIR;
Sequence CTGTAGAGTTACCTCTCACGCATCACGAGCTATACAAACAAATCGGTATTGATCCACCTC
GAGGTGTTTTACTATATGGTCCCCCTGGAACTGGCAAAACAATGCTTGCGAAAGCT
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology Genetic Information Processing > Folding, Sorting and Degradation > ko03050 Proteasome > K03063 26S proteasome regulatory subunit T3
EC
Transcription Factor Family
Transporter Classification Family 3.A.1 ATP-binding-cassette superfamily ABC ABC-type importers (all from Bacteria and Archaea)
Probeset
Corresponding NCBI Gene 835941 
Trichome-related Gene from Literature N/A