Detail of EST/Unigene AW980330 |
Acc. | AW980330 |
Internal Acc. | EST391483 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L24, chloroplastic OS=Pisum sativum E-value=1e-61; 50S ribosomal protein L24, chloroplastic OS=Arabidopsis thaliana E-value=2e-53; 50S ribosomal protein L24, chloroplastic OS=Nicotiana tabacum E-value=2e-51; 50S ribosomal protein L24, chloroplastic OS=Spinacia oleracea E-value=1e-44; 50S ribosomal protein L24 OS=Synechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6) E-value=3e-28; |
Length | 496 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_GVN; |
Sequence | TGGTAGCTATGGCTATGGCTTCTCTTCAGAGTTCCATGACCTCACTCTCACTCTCTTCCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835549 |
Trichome-related Gene from Literature | N/A |