Detail of EST/Unigene AW980423 |
Acc. | AW980423 |
Internal Acc. | EST391576 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 71B34 OS=Arabidopsis thaliana E-value=4e-41; Cytochrome P450 83B1 OS=Arabidopsis thaliana E-value=2e-39; Cytochrome P450 71B35 OS=Arabidopsis thaliana E-value=2e-39; Cytochrome P450 71B12 OS=Arabidopsis thaliana E-value=5e-39; Cytochrome P450 71B26 OS=Arabidopsis thaliana E-value=8e-39; |
Length | 724 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_GVN; |
Sequence | TTCTTTTACCCTTCGCTCTCTTGCTATTCTTCTTGTTCAAAAAACACAAAACATCTAAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07414 cytochrome P450, family 2, subfamily D; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07418 cytochrome P450, family 2, subfamily J |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822234 |
Trichome-related Gene from Literature | N/A |