Detail of EST/Unigene AW980479 |
Acc. | AW980479 |
Internal Acc. | EST391632 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Delta-aminolevulinic acid dehydratase, chloroplastic (Fragment) OS=Pisum sativum E-value=1e-66; Delta-aminolevulinic acid dehydratase, chloroplastic OS=Glycine max E-value=1e-59; Delta-aminolevulinic acid dehydratase, chloroplastic OS=Arabidopsis thaliana E-value=4e-47; Delta-aminolevulinic acid dehydratase, chloroplastic OS=Spinacia oleracea E-value=1e-46; Delta-aminolevulinic acid dehydratase, chloroplastic OS=Selaginella martensii E-value=3e-44; |
Length | 656 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_GVN; |
Sequence | AGGCCTTCTTTCACATTTCCACGCCTCATTCTCCGATCTCAATCATCAATTATGGCTTCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 4.2.1.24 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843310 |
Trichome-related Gene from Literature | N/A |