| Detail of EST/Unigene AW980796 |
| Acc. | AW980796 |
| Internal Acc. | EST391949 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Nudix hydrolase 17, mitochondrial OS=Arabidopsis thaliana E-value=8e-60; Nudix hydrolase 18, mitochondrial OS=Arabidopsis thaliana E-value=4e-59; Nudix hydrolase 4 OS=Arabidopsis thaliana E-value=7e-49; Nudix hydrolase 21, chloroplastic OS=Arabidopsis thaliana E-value=2e-45; Nudix hydrolase 12, mitochondrial OS=Arabidopsis thaliana E-value=1e-32; |
| Length | 626 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_GVN; |
| Sequence | GGTTCATTCTTAATATTCTCTCTAGTTAACATATCATCACTTGATCTCTTTTCTATATAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 3.6.1.52 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 814696 |
| Trichome-related Gene from Literature | N/A |