Detail of EST/Unigene AW981286 |
Acc. | AW981286 |
Internal Acc. | EST392439 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Linoleate 13S-lipoxygenase 2-1, chloroplastic OS=Solanum tuberosum E-value=7e-18; Lipoxygenase 2, chloroplastic OS=Arabidopsis thaliana E-value=1e-13; Lipoxygenase 2.3, chloroplastic OS=Hordeum vulgare E-value=1e-13; Lipoxygenase 2.1, chloroplastic OS=Hordeum vulgare E-value=2e-12; Probable lipoxygenase 8, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-12; |
Length | 138 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | CATTGTTTGGGTTACATCGGGGCATCATGCTGCGGTGAATTTTGGTCAGTATACTTATGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 823650 |
Trichome-related Gene from Literature | N/A |