| Detail of EST/Unigene AW981286 |
| Acc. | AW981286 |
| Internal Acc. | EST392439 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Linoleate 13S-lipoxygenase 2-1, chloroplastic OS=Solanum tuberosum E-value=7e-18; Lipoxygenase 2, chloroplastic OS=Arabidopsis thaliana E-value=1e-13; Lipoxygenase 2.3, chloroplastic OS=Hordeum vulgare E-value=1e-13; Lipoxygenase 2.1, chloroplastic OS=Hordeum vulgare E-value=2e-12; Probable lipoxygenase 8, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-12; |
| Length | 138 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL; |
| Sequence | CATTGTTTGGGTTACATCGGGGCATCATGCTGCGGTGAATTTTGGTCAGTATACTTATGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 823650 |
| Trichome-related Gene from Literature | N/A |