| Detail of EST/Unigene AW981330 |
| Acc. | AW981330 |
| Internal Acc. | EST392483 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=9e-66; Chlorophyll a-b binding protein, chloroplastic OS=Apium graveolens E-value=9e-66; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=9e-66; Chlorophyll a-b binding protein 7, chloroplastic OS=Nicotiana tabacum E-value=3e-65; Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=4e-65; |
| Length | 360 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL; |
| Sequence | ATGGTACGGTCCAGACCGTGTCAAGTACTTGGGTCCATTCTCTGGTGAAGCTCCATCTTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |