Detail of EST/Unigene AW981330 |
Acc. | AW981330 |
Internal Acc. | EST392483 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=9e-66; Chlorophyll a-b binding protein, chloroplastic OS=Apium graveolens E-value=9e-66; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=9e-66; Chlorophyll a-b binding protein 7, chloroplastic OS=Nicotiana tabacum E-value=3e-65; Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=4e-65; |
Length | 360 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | ATGGTACGGTCCAGACCGTGTCAAGTACTTGGGTCCATTCTCTGGTGAAGCTCCATCTTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |