Detail of EST/Unigene AW981478 |
Acc. | AW981478 |
Internal Acc. | EST392631 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 7, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein, chloroplastic OS=Petunia hybrida E-value=0; Chlorophyll a-b binding protein P4, chloroplastic OS=Pisum sativum E-value=1e-53; Chlorophyll a-b binding protein 4, chloroplastic OS=Arabidopsis thaliana E-value=2e-53; Chlorophyll a-b binding protein 1B-20, chloroplastic (Fragment) OS=Hordeum vulgare Ib-20 E-value=2e-41; |
Length | 711 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | TTGGAAGGAAACTGAAGGTGAACAGCAACATTGCATCACCAGTTAGAGTGAGATCTACCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825320 |
Trichome-related Gene from Literature | N/A |