Detail of EST/Unigene AY324396 |
Acc. | AY324396 |
Internal Acc. | |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Alternative oxidase 2, mitochondrial OS=Glycine max E-value=3e-85; Alternative oxidase, mitochondrial OS=Mangifera indica 1 E-value=6e-84; Alternative oxidase 2, mitochondrial OS=Arabidopsis thaliana E-value=3e-83; Alternative oxidase 3, mitochondrial OS=Glycine max E-value=5e-81; Alternative oxidase 1a, mitochondrial OS=Arabidopsis thaliana E-value=2e-79; |
Length | 613 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_CDS (1 ESTs); |
Sequence | TTGGAAACAGTGGCAGGTGTACCTGGAATGGTTGGAGGTATGCTGTTACATCTGAGGTCA |
EST members of Unigene | AY324396 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836542 |
Trichome-related Gene from Literature | 836542 |