| Detail of EST/Unigene BE123892 |
| Acc. | BE123892 |
| Internal Acc. | EST394017 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L5, chloroplastic OS=Arabidopsis thaliana E-value=1e-41; 50S ribosomal protein L5, chloroplastic OS=Spinacia oleracea E-value=1e-38; 50S ribosomal protein L5, chloroplastic OS=Oryza sativa subsp. japonica E-value=9e-33; 50S ribosomal protein L5, chloroplastic OS=Mesostigma viride E-value=3e-24; 50S ribosomal protein L5, cyanelle OS=Cyanophora paradoxa E-value=4e-24; |
| Length | 554 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL; |
| Sequence | AGAAAGCAAGCAAGATCTGCATGATCATCATACAACCATATAATAACGTGATTGATGGCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827947 |
| Trichome-related Gene from Literature | N/A |