Detail of EST/Unigene BE123892 |
Acc. | BE123892 |
Internal Acc. | EST394017 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L5, chloroplastic OS=Arabidopsis thaliana E-value=1e-41; 50S ribosomal protein L5, chloroplastic OS=Spinacia oleracea E-value=1e-38; 50S ribosomal protein L5, chloroplastic OS=Oryza sativa subsp. japonica E-value=9e-33; 50S ribosomal protein L5, chloroplastic OS=Mesostigma viride E-value=3e-24; 50S ribosomal protein L5, cyanelle OS=Cyanophora paradoxa E-value=4e-24; |
Length | 554 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | AGAAAGCAAGCAAGATCTGCATGATCATCATACAACCATATAATAACGTGATTGATGGCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827947 |
Trichome-related Gene from Literature | N/A |