Detail of EST/Unigene BE124011 |
Acc. | BE124011 |
Internal Acc. | EST394136 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein 2, chloroplastic OS=Spinacia oleracea E-value=7e-53; 33 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=2e-23; 28 kDa ribonucleoprotein, chloroplastic OS=Spinacia oleracea E-value=9e-21; 31 kDa ribonucleoprotein, chloroplastic OS=Nicotiana plumbaginifolia E-value=1e-20; 29 kDa ribonucleoprotein A, chloroplastic OS=Nicotiana sylvestris E-value=1e-20; |
Length | 602 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | CGAGGCCTCGTGCCGCTCTACTCTCACAACTCAATTTCCTTTCTGTAACTCACAACAACA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824379 |
Trichome-related Gene from Literature | N/A |