Detail of EST/Unigene BE124120 |
Acc. | BE124120 |
Internal Acc. | EST394245 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Geraniol 8-hydroxylase OS=Catharanthus roseus E-value=3e-42; Geraniol 8-hydroxylase OS=Swertia mussotii E-value=2e-40; Cytochrome P450 76C4 OS=Arabidopsis thaliana E-value=6e-32; 7-ethoxycoumarin O-deethylase OS=Helianthus tuberosus E-value=4e-31; Cytochrome P450 76C2 OS=Arabidopsis thaliana E-value=6e-30; |
Length | 586 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | CTTTGTTCTCTATGGATTTGGCACATTCCACAGTACCTGATGAGAAGTCTCAAGAATTTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1 |
EC | 1.14.14.1 1.14.99.9 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 840264 |
Trichome-related Gene from Literature | N/A |