| Detail of EST/Unigene BE124120 |
| Acc. | BE124120 |
| Internal Acc. | EST394245 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Geraniol 8-hydroxylase OS=Catharanthus roseus E-value=3e-42; Geraniol 8-hydroxylase OS=Swertia mussotii E-value=2e-40; Cytochrome P450 76C4 OS=Arabidopsis thaliana E-value=6e-32; 7-ethoxycoumarin O-deethylase OS=Helianthus tuberosus E-value=4e-31; Cytochrome P450 76C2 OS=Arabidopsis thaliana E-value=6e-30; |
| Length | 586 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL; |
| Sequence | CTTTGTTCTCTATGGATTTGGCACATTCCACAGTACCTGATGAGAAGTCTCAAGAATTTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1 |
| EC | 1.14.14.1 1.14.99.9 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 840264 |
| Trichome-related Gene from Literature | N/A |