Detail of EST/Unigene BE124136 |
Acc. | BE124136 |
Internal Acc. | EST394261 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin M3, chloroplastic OS=Arabidopsis thaliana E-value=2e-41; Thioredoxin M3, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-28; Thioredoxin M-type, chloroplastic OS=Pisum sativum E-value=1e-26; Thioredoxin M-type, chloroplastic OS=Chlamydomonas reinhardtii E-value=2e-26; Thioredoxin M2, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-26; |
Length | 650 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSIL; |
Sequence | GCTTCCTCAACTTCCCTTTCTCTGACTTCTTCCTCTCACCTTCACATACCCACATTCTCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 816050 |
Trichome-related Gene from Literature | N/A |