Detail of EST/Unigene BE124391 |
Acc. | BE124391 |
Internal Acc. | EST393426 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Digalactosyldiacylglycerol synthase 2, chloroplastic OS=Lotus japonicus E-value=5e-60; Digalactosyldiacylglycerol synthase 2, chloroplastic OS=Glycine max E-value=1e-59; Digalactosyldiacylglycerol synthase 2, chloroplastic OS=Arabidopsis thaliana E-value=2e-51; Digalactosyldiacylglycerol synthase 1, chloroplastic OS=Arabidopsis thaliana E-value=5e-48; Digalactosyldiacylglycerol synthase 1, chloroplastic OS=Glycine max E-value=3e-46; |
Length | 543 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_GVN; |
Sequence | GATCGTCGCCGCTGCTTCTCTCCTTCTTTCCACCGCCACCAAAAAGTTAAAGTGATCAGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827960 |
Trichome-related Gene from Literature | N/A |