| Detail of EST/Unigene BE124607 |
| Acc. | BE124607 |
| Internal Acc. | EST393642 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 13 OS=Arabidopsis thaliana E-value=3e-17; Glucan endo-1,3-beta-glucosidase 1 OS=Arabidopsis thaliana E-value=5e-17; Glucan endo-1,3-beta-glucosidase 4 OS=Arabidopsis thaliana E-value=2e-16; Glucan endo-1,3-beta-glucosidase 3 OS=Arabidopsis thaliana E-value=3e-16; Glucan endo-1,3-beta-glucosidase 12 OS=Arabidopsis thaliana E-value=1e-15; |
| Length | 587 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_GVN; |
| Sequence | TTTGCAGCACTATCTCGTTTAAAATACGACGATATAAACGTCGTCGTTTCGGAAACGGGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 815130 |
| Trichome-related Gene from Literature | N/A |