| Detail of EST/Unigene BE124893 |
| Acc. | BE124893 |
| Internal Acc. | EST393928 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Linoleate 9S-lipoxygenase OS=Lens culinaris E-value=0; Linoleate 9S-lipoxygenase-4 OS=Glycine max E-value=3e-90; Linoleate 9S-lipoxygenase (Fragment) OS=Phaseolus vulgaris E-value=2e-86; Seed linoleate 9S-lipoxygenase-3 OS=Pisum sativum E-value=8e-85; Seed linoleate 9S-lipoxygenase-3 OS=Glycine max E-value=3e-84; |
| Length | 651 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_GVN; |
| Sequence | TGGAGAATATGTGAGTTTCTACTACAAATCAGATGCTGCCATTGCACAAGATGCTGAACT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00461 arachidonate 5-lipoxygenase; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K00461 arachidonate 5-lipoxygenase; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K08022 arachidonate 15-lipoxygenase (second type) / 8-lipoxygenase (S-type) |
| EC | 1.13.11.- 1.13.11.33 1.13.11.34 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821808 |
| Trichome-related Gene from Literature | N/A |