Detail of EST/Unigene BE187628 |
Acc. | BE187628 |
Internal Acc. | EST336189 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | RuBisCO large subunit-binding protein subunit beta, chloroplastic OS=Pisum sativum E-value=3e-79; Chaperonin 60 subunit beta 3, chloroplastic OS=Arabidopsis thaliana E-value=4e-72; RuBisCO large subunit-binding protein subunit beta, chloroplastic OS=Brassica napus E-value=2e-71; Chaperonin 60 subunit beta 2, chloroplastic OS=Arabidopsis thaliana E-value=2e-71; Chaperonin 60 subunit beta 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-69; |
Length | 617 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV0; |
Sequence | AACCCTAGCCACCATTTTCTCCCAATTCCACACTACCATGGCGTCATTAAATCTATCCTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835751 |
Trichome-related Gene from Literature | N/A |