| Detail of EST/Unigene BE202913 |
| Acc. | BE202913 |
| Internal Acc. | EST402935 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Aldo-keto reductase family 4 member C9 OS=Arabidopsis thaliana E-value=7e-39; Aldo-keto reductase family 4 member C10 OS=Arabidopsis thaliana E-value=1e-37; Aldo-keto reductase family 4 member C11 OS=Arabidopsis thaliana E-value=3e-35; Aldo-keto reductase family 4 member C8 OS=Arabidopsis thaliana E-value=4e-32; Alcohol dehydrogenase [NADP(+)] OS=Pongo abelii E-value=2e-23; |
| Length | 386 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV1; |
| Sequence | AGGTACTTTGCAAGCTTTACCCGGTGTTGTTGCCAAAGGTGTCACCGGTGCTGTTCAAGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00930 Caprolactam degradation > K00002 alcohol dehydrogenase (NADP+); Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00002 alcohol dehydrogenase (NADP+); Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00002 alcohol dehydrogenase (NADP+) |
| EC | 1.1.1.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818354 |
| Trichome-related Gene from Literature | N/A |