| Detail of EST/Unigene BE203010 |
| Acc. | BE203010 |
| Internal Acc. | EST403032 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Sulfite reductase [ferredoxin], chloroplastic OS=Pisum sativum E-value=8e-16; Sulfite reductase 1 [ferredoxin], chloroplastic OS=Nicotiana tabacum E-value=2e-15; Sulfite reductase [ferredoxin], chloroplastic OS=Arabidopsis thaliana E-value=2e-15; Sulfite reductase [ferredoxin], chloroplastic (Fragment) OS=Glycine max E-value=4e-15; Sulfite reductase [ferredoxin], chloroplastic OS=Zea mays E-value=2e-13; |
| Length | 124 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV1; |
| Sequence | GTGCCATGTTTGAGAAGGTTGGTCTGAAGTATATCGAATCTGTCGTTGTAAGGATAACTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830336 |
| Trichome-related Gene from Literature | 830336 |