Detail of EST/Unigene BE203556 |
Acc. | BE203556 |
Internal Acc. | EST396232 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Translation factor GUF1 homolog, chloroplastic OS=Ricinus communis E-value=3e-50; Translation factor GUF1 homolog, chloroplastic OS=Vitis vinifera E-value=4e-50; Translation factor GUF1 homolog, chloroplastic OS=Populus trichocarpa E-value=5e-49; Translation factor GUF1 homolog, chloroplastic OS=Arabidopsis thaliana E-value=8e-49; Translation factor GUF1 homolog, chloroplastic OS=Oryza sativa subsp. japonica E-value=7e-48; |
Length | 478 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV0; |
Sequence | ATCCGTTAAAACTCAACGGTTACTCCACCATTCTCAACGAACACCAATAACCGCCAGTAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.6.5.3 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830766 |
Trichome-related Gene from Literature | N/A |