| Detail of EST/Unigene BE203713 |
| Acc. | BE203713 |
| Internal Acc. | EST396389 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | NAD(P)H-dependent 6'-deoxychalcone synthase OS=Glycine max E-value=5e-70; NADPH-dependent codeinone reductase 1-3 OS=Papaver somniferum E-value=2e-35; NADPH-dependent codeinone reductase 1-1 OS=Papaver somniferum E-value=5e-35; NADPH-dependent codeinone reductase 1-5 OS=Papaver somniferum E-value=6e-35; NADPH-dependent codeinone reductase 1-4 OS=Papaver somniferum E-value=1e-34; |
| Length | 426 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV0; |
| Sequence | CCAACAAAGGTTCTTACAAACACATCTAGTCAATTGAAGATGCCAGTGGTTGGAATGGGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00930 Caprolactam degradation > K00002 alcohol dehydrogenase (NADP+); Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00002 alcohol dehydrogenase (NADP+); Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00002 alcohol dehydrogenase (NADP+) |
| EC | 1.1.1.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842290 |
| Trichome-related Gene from Literature | N/A |