Detail of EST/Unigene BE203902 |
Acc. | BE203902 |
Internal Acc. | EST396578 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione peroxidase 5 OS=Arabidopsis thaliana E-value=2e-32; Probable phospholipid hydroperoxide glutathione peroxidase OS=Solanum lycopersicum E-value=8e-32; Probable phospholipid hydroperoxide glutathione peroxidase OS=Helianthus annuus E-value=1e-31; Putative glutathione peroxidase 7, chloroplastic OS=Arabidopsis thaliana E-value=2e-31; Probable phospholipid hydroperoxide glutathione peroxidase OS=Spinacia oleracea E-value=2e-31; |
Length | 567 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV0; |
Sequence | GCATTTACCAGCCAAATGTAATACACATTCCTATTTATGCGTTTATATAAACAAATAACA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00432 glutathione peroxidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00432 glutathione peroxidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K05361 phospholipid-hydroperoxide glutathione peroxidase |
EC | 1.11.1.12 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825483 |
Trichome-related Gene from Literature | N/A |