Detail of EST/Unigene BE203944 |
Acc. | BE203944 |
Internal Acc. | EST396620 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Alanine aminotransferase 1, mitochondrial OS=Arabidopsis thaliana E-value=1e-77; Alanine aminotransferase 2, mitochondrial OS=Arabidopsis thaliana E-value=7e-76; Alanine aminotransferase 2 OS=Panicum miliaceum E-value=4e-74; Alanine aminotransferase 2 OS=Hordeum vulgare E-value=2e-70; Putative alanine aminotransferase OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=6e-40; |
Length | 514 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV0; |
Sequence | CCTCAGGTTCTGAAATGTCAGTATGCTGTTCGAGGAGAGATTGTTACACTTGCTCAGAAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00814 alanine transaminase; Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K00814 alanine transaminase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K00814 alanine transaminase |
EC | 2.6.1.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838301 |
Trichome-related Gene from Literature | N/A |