Detail of EST/Unigene BE203980 |
Acc. | BE203980 |
Internal Acc. | EST396656 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | UDP-glucose 6-dehydrogenase OS=Glycine max E-value=9e-75; Probable UDP-glucose 6-dehydrogenase 1 OS=Arabidopsis thaliana E-value=3e-73; Probable UDP-glucose 6-dehydrogenase 2 OS=Arabidopsis thaliana E-value=1e-71; UDP-glucose 6-dehydrogenase OS=Drosophila melanogaster E-value=3e-52; UDP-glucose 6-dehydrogenase OS=Gallus gallus E-value=1e-48; |
Length | 444 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV0; |
Sequence | AAAAGCAAAATGGTGAAGATTTGCTGCATTGGTGCCGGATATGTCGGTGGTCCAACAATG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00053 Ascorbate and aldarate metabolism > K00012 UDPglucose 6-dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00520 Nucleotide sugars metabolism > K00012 UDPglucose 6-dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00012 UDPglucose 6-dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00012 UDPglucose 6-dehydrogenase |
EC | 1.1.1.22 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822594 |
Trichome-related Gene from Literature | N/A |