Detail of EST/Unigene BE204100
Acc. BE204100
Internal Acc. EST396776
Type EST
Annotation (Top 5 hits in Uniprot_trembl) 40S ribosomal protein S2-3 OS=Arabidopsis thaliana E-value=2e-10; 40S ribosomal protein S2-2 OS=Arabidopsis thaliana E-value=2e-10; 40S ribosomal protein S2-1 OS=Arabidopsis thaliana E-value=2e-10; 40S ribosomal protein S2-4 OS=Arabidopsis thaliana E-value=5e-10; 40S ribosomal protein S2 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=1e-06;
Length 108 nt
Species Medicago truncatula
Belonged EST Libraries MT_SROOT_KV0;
Sequence CATCTATCTTCATTCTCTCCCAATCAAGGAGCACCAAATCATTGATACCCTCGTGGGTCC
CACTCTCAAGGATGAGGTGATGAACATCATGCCCGTTCATAAACAAAC
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology Genetic Information Processing > Translation > ko03010 Ribosome > K02981 small subunit ribosomal protein S2e
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 818784 
Trichome-related Gene from Literature N/A