Detail of EST/Unigene BE204130 |
Acc. | BE204130 |
Internal Acc. | EST396806 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Malate dehydrogenase, cytoplasmic OS=Medicago sativa E-value=0; Malate dehydrogenase, cytoplasmic OS=Zea mays E-value=2e-97; Malate dehydrogenase, cytoplasmic OS=Oryza sativa subsp. japonica E-value=3e-96; Malate dehydrogenase, cytoplasmic 1 OS=Arabidopsis thaliana E-value=4e-96; Malate dehydrogenase, cytoplasmic 2 OS=Arabidopsis thaliana E-value=1e-95; |
Length | 630 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV0; |
Sequence | ACTCTTGTTTCTCTTCTCATCAATCTTCCATTTTCGATTCCTTTCATTTCATCAAAAATG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00020 Citrate cycle (TCA cycle) > K00026 malate dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00630 Glyoxylate and dicarboxylate metabolism > K00026 malate dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00026 malate dehydrogenase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00026 malate dehydrogenase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K00026 malate dehydrogenase |
EC | 1.1.1.37 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839527 |
Trichome-related Gene from Literature | N/A |