Detail of EST/Unigene BE204209 |
Acc. | BE204209 |
Internal Acc. | EST396885 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Serine hydroxymethyltransferase 2 OS=Dictyostelium discoideum E-value=3e-70; Serine hydroxymethyltransferase 1 OS=Dictyostelium discoideum E-value=6e-70; Serine hydroxymethyltransferase, cytosolic OS=Pongo abelii E-value=2e-65; Serine hydroxymethyltransferase, cytosolic OS=Oryctolagus cuniculus E-value=5e-65; Serine hydroxymethyltransferase, cytosolic OS=Mus musculus E-value=2e-64; |
Length | 607 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV0; |
Sequence | ATCCACCAGATCGAAAACATTTGCCGCTCACGCGCTCTCACCGCCTTCCACCTCGACGCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00680 Methane metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00670 One carbon pool by folate > K00600 glycine hydroxymethyltransferase |
EC | 2.1.2.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827027 |
Trichome-related Gene from Literature | N/A |