Detail of EST/Unigene BE204242 |
Acc. | BE204242 |
Internal Acc. | EST396918 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ketol-acid reductoisomerase, chloroplastic OS=Pisum sativum E-value=2e-87; Ketol-acid reductoisomerase, chloroplastic OS=Arabidopsis thaliana E-value=3e-70; Ketol-acid reductoisomerase, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-68; Ketol-acid reductoisomerase, chloroplastic OS=Spinacia oleracea E-value=5e-65; Ketol-acid reductoisomerase OS=Salinibacter ruber (strain DSM 13855 / M31) E-value=1e-10; |
Length | 572 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV0; |
Sequence | ACCCTAACAAAGCCAACCACCACAAGCTTCGCCGCCGCTAATCTCTCATTTTCGAAGCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825030 |
Trichome-related Gene from Literature | N/A |