| Detail of EST/Unigene BE204265 |
| Acc. | BE204265 |
| Internal Acc. | EST396941 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=5e-13; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=6e-13; Chlorophyll a-b binding protein 3A, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=1e-06; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=3e-06; Chlorophyll a-b binding protein 3B, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=3e-06; |
| Length | 167 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV0; |
| Sequence | TTCATTGCAAAATGGCCGCATCATCCATGGCTCTCTCTTCACCAACCTTGGCTGGCAAGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818006 |
| Trichome-related Gene from Literature | N/A |