| Detail of EST/Unigene BE204292 |
| Acc. | BE204292 |
| Internal Acc. | EST396968 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Aconitate hydratase 1 OS=Arabidopsis thaliana E-value=0; Aconitate hydratase, cytoplasmic OS=Cucurbita maxima E-value=0; Aconitate hydratase 2, mitochondrial OS=Arabidopsis thaliana E-value=0; Putative aconitate hydratase, cytoplasmic OS=Oryza sativa subsp. japonica E-value=0; Aconitate hydratase 3, mitochondrial OS=Arabidopsis thaliana E-value=8e-96; |
| Length | 665 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SROOT_KV0; |
| Sequence | CTCAATCTCTTACCATGGCAACTCAAAATCCATTCAACAACATATTGAAGACACTGGAAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00020 Citrate cycle (TCA cycle) > K01681 aconitate hydratase 1; Metabolism > Carbohydrate Metabolism > ko00630 Glyoxylate and dicarboxylate metabolism > K01681 aconitate hydratase 1; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01681 aconitate hydratase 1 |
| EC | 4.2.1.3 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829737 |
| Trichome-related Gene from Literature | N/A |