Detail of EST/Unigene BE204810 |
Acc. | BE204810 |
Internal Acc. | EST397486 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Phosphatase IMPL1, chloroplastic OS=Arabidopsis thaliana E-value=5e-48; Inositol-1-monophosphatase OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=3e-16; Inositol monophosphatase 3 OS=Solanum lycopersicum E-value=1e-14; Inositol monophosphatase 1 OS=Solanum lycopersicum E-value=8e-14; Inositol-1-monophosphatase OS=Pasteurella multocida (strain Pm70) E-value=1e-13; |
Length | 576 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV0; |
Sequence | CTCTTCCTTGGTTCCACCCATCCATCTCTTAGCTCATTTTGATCGATCATAATGATGTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K01092 myo-inositol-1(or 4)-monophosphatase; Metabolism > Carbohydrate Metabolism > ko00562 Inositol phosphate metabolism > K01092 myo-inositol-1(or 4)-monophosphatase; Environmental Information Processing > Signal Transduction > ko04070 Phosphatidylinositol signaling system > K01092 myo-inositol-1(or 4)-monophosphatase |
EC | 3.1.3.25 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 840007 |
Trichome-related Gene from Literature | N/A |