Detail of EST/Unigene BE204853 |
Acc. | BE204853 |
Internal Acc. | EST397593 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Vigna radiata var. radiata E-value=5e-62; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Glycine max E-value=2e-60; Omega-3 fatty acid desaturase, chloroplastic (Fragment) OS=Brassica napus E-value=1e-58; Omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=4e-58; Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=5e-58; |
Length | 557 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV0; |
Sequence | CGAGCCTCCACCACCACAACAACATTGTTAGCAGAGAGAACATCAACTACAATGGCTGTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820288 |
Trichome-related Gene from Literature | 820288 |