Detail of EST/Unigene BE204900 |
Acc. | BE204900 |
Internal Acc. | EST397520 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Carbamoyl-phosphate synthase small chain OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=1e-44; Carbamoyl-phosphate synthase small chain OS=Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1) E-value=1e-43; Carbamoyl-phosphate synthase small chain OS=Synechococcus elongatus (strain PCC 7942) E-value=1e-43; Carbamoyl-phosphate synthase small chain OS=Pelobacter carbinolicus (strain DSM 2380 / Gra Bd 1) E-value=2e-43; Carbamoyl-phosphate synthase small chain OS=Halomonas eurihalina E-value=2e-42; |
Length | 601 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV0; |
Sequence | GGGAATACTGGCATAAATTTTGATGACGAGGAATCAACGCAGTGCTTTCTTTCTGGTCTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K11540 carbamoyl-phosphate synthase / aspartate carbamoyltransferase / dihydroorotase; Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K11540 carbamoyl-phosphate synthase / aspartate carbamoyltransferase / dihydroorotase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K11540 carbamoyl-phosphate synthase / aspartate carbamoyltransferase / dihydroorotase |
EC | 2.1.3.2 3.5.2.3 6.3.5.5 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822396 |
Trichome-related Gene from Literature | N/A |