Detail of EST/Unigene BE204982 |
Acc. | BE204982 |
Internal Acc. | EST397658 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-6 fatty acid desaturase, chloroplastic OS=Glycine max E-value=3e-66; Omega-6 fatty acid desaturase, chloroplastic OS=Brassica napus E-value=2e-53; Omega-6 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=2e-53; Omega-6 fatty acid desaturase, chloroplastic OS=Spinacia oleracea E-value=7e-52; Fatty acid desaturase OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=1e-19; |
Length | 473 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV0; |
Sequence | CATTTCTGCTCCTTACTCACGCGGCTTATTTAACCTAAAAGGTGATGGGTTAATCCATAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829220 |
Trichome-related Gene from Literature | N/A |