Detail of EST/Unigene BE205034 |
Acc. | BE205034 |
Internal Acc. | EST397710 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Isoflavone 2'-hydroxylase OS=Glycyrrhiza echinata E-value=3e-98; Cytochrome P450 81D1 OS=Arabidopsis thaliana E-value=1e-65; Cytochrome P450 81F1 OS=Arabidopsis thaliana E-value=4e-59; Cytochrome P450 82C4 OS=Arabidopsis thaliana E-value=5e-42; Geraniol 8-hydroxylase OS=Catharanthus roseus E-value=6e-41; |
Length | 593 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV0; |
Sequence | GAGTGGACTCCTTCAAGAGCAACGTAGCAAGAAAGAACGTACAAATACCATGATAGATCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07422 cytochrome P450, family 2, subfamily U |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829891 |
Trichome-related Gene from Literature | N/A |