Detail of EST/Unigene BE205478 |
Acc. | BE205478 |
Internal Acc. | EST398154 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Phosphoglucomutase, cytoplasmic OS=Pisum sativum E-value=3e-96; Phosphoglucomutase, cytoplasmic OS=Solanum tuberosum E-value=2e-85; Phosphoglucomutase, cytoplasmic OS=Populus tremula E-value=8e-85; Probable phosphoglucomutase, cytoplasmic 2 OS=Arabidopsis thaliana E-value=4e-83; Phosphoglucomutase, cytoplasmic OS=Mesembryanthemum crystallinum E-value=3e-82; |
Length | 564 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV0; |
Sequence | AATCAATCAACCATGGTGCTCTTCAATGTCTCCCGTATTGAAACTACTCCTTTCGATGGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K01835 phosphoglucomutase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01835 phosphoglucomutase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K01835 phosphoglucomutase; Metabolism > Carbohydrate Metabolism > ko00030 Pentose phosphate pathway > K01835 phosphoglucomutase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K01835 phosphoglucomutase |
EC | 5.4.2.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843410 |
Trichome-related Gene from Literature | N/A |